54088

Joke of the Day

"[office meeting] BOSS: Printer ink is costing us a ton. Any ideas on how to cut costs? SQUID: *looks up from phone* Why y'all lookin' at me?"

"BREAKING NEWS: They just found Hillary's emails. 30 thousand 'penis enlargement' offers."

"I lost my virginity to my priest... ... he told me to pray to St. Anthony"

"A DNA molecule walks into a bar ""What will it be?"" asks the bartender. ""ATCGGCAGGCTTCAGTTGCA"" says the DNA molecule."

"No one is more excited for today than Michael J. Fox... He's been shaking with anticipation for the last 25 years."

"""Tom Brady did nothing wrong"" is Boston's ""The Confederate Flag isn't really about slavery."""

"Did you hear about the giant that threw up? It's all over town."

"I feel bad for lions at zoos. How would you feel if a bunch of pizzas came to your house, took your picture, and you couldn't even eat them."

"What did the pirate say after his first-mate stuck the wheel in his pants? ""ARGHH! You're driving me nuts!"""

"""Wanna pop a xanax in the Civic and kayak with mom and dad at noon?"" ""Can't. Scared."" ""Of the water?"" ""No. Palindromes."""