132648

Joke of the Day

"A DNA molecule walks into a bar ""What will it be?"" asks the bartender. ""ATCGGCAGGCTTCAGTTGCA"" says the DNA molecule."

"GOD: no work on the sabbath or I'll kill you ISRAEL [hasn't had a day off in 400 years]: awesome! GOD: what ISRAEL: we mean...oh no so hard"

"If Turkey was attacked from the rear Would Greece help?"

"How many potatoes does it take to kill an Irishman? None. 1845 never forget."

"(Xpost: showerthoughts) Knock-knock jokes should win the No-Bell Prize"

"Skinny Jeans All jeans are skinny jeans if you're fat enough."

"Every toddler is basically a 1/8th scale model of a person on bath salts."

"Childish immature jokes are the best * Step 1: say ""eye"" * Step 2: spell the word ""map"" * Step 3: say ""nus"" * Now say that all together..."

"Mr. Trump, who's your Secretary of State? TRUMP: To deal with China, one that speaks Mandarin [remembers to appeal to women] or Womandarin"

"What's the first thing you do when attacked by a gang of clowns? Go straight for the juggler."