162296

Joke of the Day

"Hey, guy in Prius blasting heavy metal - decide which type of annoying person you want to be."

"A man arrives home and was absolutely delighted when he saw that someone had stolen every single lamp from his house"

"So I was fucking this guy in the ass..... ... and I reached around and he had a boner. Do you think he's gay?"

"A DNA molecule walks into a bar ""What will it be?"" asks the bartender. ""ATCGGCAGGCTTCAGTTGCA"" says the DNA molecule."

"What's a gay man's favorite time? Eight a'cock"

"[NSFW] My favorite sex position is the JFK... I splatter all over her while she screams and tries to get out of the car."

"Did you hear about the guy who opened a cheese store in Israel? He called it ""Cheeses of Nazareth""."

"It was a blessing that grandpa past away peacfully in his sleep, but tragic for the passengers in his car."

"People Don't even say grace before meals anymore . They just Hold up Their Phones over the Plate , snap a Pic , & Post it on Instagram"

"Well - It's not the first time Donald has left a Bush disappointed..."