81136
Joke of the Day
"What's red and crawls up your leg? A homesick abortion."
Next Joke
"*takes a picture of food for Instagram* Food: delete it"
"Why did the cowboy adopt a wiener dog? He was told to get a long little doggy..."
"Donald Trump's tweets are actually really entertaining if you imagine him tweeting from a gold toilet while having violent diarrhea."
"Yo Mama so Old... She pre-ordered the BIble!"
"Little boy to airline pilot: ""You're a pilot?!?!? That must be exciting."" Pilot: ""Not if I do it right."""
"What type of humor did the heart attack survivor like? Offbeat."
"there's a portal to another dimension underneath Zooey Deschanel's bangs and I am determined to use it to meet Benjamin Franklin"
"16 sodium atoms walks into a bar.... followed by Batman."
"A DNA molecule walks into a bar ""What will it be?"" asks the bartender. ""ATCGGCAGGCTTCAGTTGCA"" says the DNA molecule."