180057

Joke of the Day

"Don't be stupid, if their ex is still calling it's because they're still getting an answer."

Next Joke
 
"Heard the one about the three blondes that went ice fishing and didn't catch anything? By the time they cut a hole big enough for the boat to fit in it was time to go home."
"A DNA molecule walks into a bar ""What will it be?"" asks the bartender. ""ATCGGCAGGCTTCAGTTGCA"" says the DNA molecule."
"what's th difference between a gay man and a refrigerator? the refrigerator doesn't fart when you take the meat out."
"I've recently admitted to being a masochist. The realization has been painful, but I like it."
"Have you ever had sex while camping? Its fucking in tents!"
"That moment when you make out with the air trying to find the straw in your glass"
"Had a very hot curry last night and now my asshole is on fire ... I'm suffering from deja vindaloo."
"What do you call a myth from the middle east? A turban legend"
"How do you pickup chicks in Auschwitz ? With a dustpan.."