819

Joke of the Day

"what is the best way to smuggle drugs? In your dogs asshole. Should there be border control frisking, it will be perceived as two dogs plain wolfing"

"A DNA molecule walks into a bar ""What will it be?"" asks the bartender. ""ATCGGCAGGCTTCAGTTGCA"" says the DNA molecule."

"Damn girl you must have been out in the sun all day. Because you appealin'"

"I need Irish jokes, pronto! Just 'cause"

"Who are you going to trust, some real doctor who says it's impossible to make you a centaur, or me, the guy with a hacksaw and half a horse?"

"Helen Keller walks into a bar And a chair...and a table"

"I'm the cat whisperer. because I whisper, ""I could kill you with my bare hands"" to them daily."

"6:30 is the best time on a clock... ...hands down."

"Just got added to a list called ""people."" Glad I made that cut."

"Ladies : Who's the man who, with just the slightest touch- gives you chills and makes you tremble with anticipation ? Your dentist."