150166

Joke of the Day

"America & UK are competing to see who can fuck up their country the most... UK is in the lead... but America has a Trump card."

Next Joke
 
"One of the best ways to prepare for marriage is to wait 15 minutes in your car before going anywhere."
"im smart. if asian equals pi then four times four is sixteen told you i was smart..."
"ME: [in g-string and hardhat] You sure this is what Boss meant by strip-mining? [A bat swoops down and tucks a crumpled bill into my thong]"
"What do you call a fish with no eyes? A fsh. Eh, it works better if you tell it out loud, but you get the ... eye-dea."
"Optimus Prime partially clothed ... Semi-nude."
"My wife was preparing to bake bread... I asked what that was she was putting into the mix. She said, ""dill weed"". I said, ""Darling, you know I love your recipes, but I refuse to eat dill dough!""."
"How did Hellen Keller break her arms when she fell down a well? She was shouting for help."
"What do you call a 100 spiders on a tyre ? A spinning wheel !"
"A DNA molecule walks into a bar ""What will it be?"" asks the bartender. ""ATCGGCAGGCTTCAGTTGCA"" says the DNA molecule."