96954

Joke of the Day

"Did you hear about the cannibal who passed his brother in the woods one day? ...just think about it."

"My girlfriend and I couldn't agree on which guitar strings to play In the end we struck an A Chord"

"A DNA molecule walks into a bar ""What will it be?"" asks the bartender. ""ATCGGCAGGCTTCAGTTGCA"" says the DNA molecule."

"Interview Joke Interviewer: Why should we hire you Interviewee: Coz you are hiring :)"

"My daughter reached that age where they start asking embarrassing questions about sex The last one was ""is that all you got?"""

"Why do you get aroused when you look in the mirror? Because your dick thinks you're a pussy too."

"[Command Center] *opens map* *traces route* *marks intercept point* *drives* *waits* *target arrives *tackles* Liquor Delivery Guy: Again?"

"I hate when I put my open beer down and forget where I put it and then I find like 7 open beers."

"Sad that at 36 I have yet to experience the dirty dancing lift. If it doesn't happen by 40 I'll just start running at random strangers."

"COP: do you know why I pulled you over ME: knock knock COP: who's there ME: do you know why I pulled you over COP: *begins to sweat* n..no"